priligy dapoxetine review The same was used for the amplification of ObRb, ObRt, ER, aromatase and 18S control genes under initial amplification conditions at 94 C for 5 minutes, 35 cycles 94 C for 30 seconds, 57 C for 30 seconds, 72 C for 60 seconds and a final extension at 72 C for 10 minutes, using the HotStarTaq DNA Polymerase, QIAGEN, Germany and the following pairs of primers ObRb Fw 5 GATAGAGGCCCAGGCATTTTTTA 3, Rv 5 ACACCACTCTCTCTCTTTTTGATTGA 3, ObRt, Fw 5 CATTTTATCCCC ATTGAGAAG TA 3, Rv 5 CTGAAAATTAAGTCCTTGTGCCCA 3, ER Fw 5 GTGTACAACTACCCCGAGGGC 3, Rv 5 AAACCCCCCAGGCCGTTGGAG 3 and aromatase Fw 5 CAAGGTTATTTTGAT GCATGG 3, Rv 5 AATCCTTGACAGACTTCTCAT 3, gene 18S Fw 5 GTC TGTGATGCCCTTAGA TG 3, Rv 5 AGCTTATGACCCGCACTTAC 3